chr11:5248028:GCCTAAGGGTGGGAAAATAGACCAA> Detail (hg19) (HBB, LOC106099062, LOC107133510)
Information
Genome
Assembly | Position |
---|---|
hg19 | chr11:5,248,028-5,248,052 |
hg38 | chr11:5,226,798-5,226,822 |
HGVS
Type | Transcript | Protein |
---|---|---|
RefSeq | NM_000518.4:c.93-23_94delTTGGTCTATTTTCCCACCCTTAGGC | NP_000509.1:p.Arg31SerfsTer13 |
Ensemble | ENST00000335295.4:c.93-23_94delTTGGTCTATTTTCCCACCCTTAGGC | ENST00000335295.4:p.Arg31SerfsTer13 |
ENST00000485743.1:c.93-23_94delTTGGTCTATTTTCCCACCCTTAGGC | ENST00000485743.1:p.Arg31SerfsTer13 |
Summary
MGeND
Clinical significance | |
Variant entry | |
GWAS entry | |
Disease area statistics | Show details |
Disease area statistics
[No Data.]
MGeND
[No Data.]
ClinVar
Clinical significance | Last evaluated | Review status | Condition | Origin | Links |
---|---|---|---|---|---|
![]() |
1983-07-25 | no assertion criteria provided | Beta zero thalassemia |
![]() |
Detail |
![]() |
2022-11-03 | criteria provided, multiple submitters, no conflicts | beta thalassemia |
![]() |
Detail |
![]() |
2024-01-04 | criteria provided, multiple submitters, no conflicts | not provided |
![]() |
Detail |
no classifications from unflagged records | no classifications from unflagged records | not specified |
![]() |
Detail | |
![]() |
2017-06-16 | criteria provided, single submitter | Inborn genetic diseases |
![]() |
Detail |
![]() |
2023-02-23 | criteria provided, multiple submitters, no conflicts | Beta-thalassemia HBB/LCRB |
![]() ![]() |
Detail |
![]() |
2024-03-26 | criteria provided, single submitter | Malaria, susceptibility to |
![]() |
Detail |
CIViC
[No Data.]
DisGeNET
Score | Disease name | Description | Source | Pubmed | Links |
---|---|---|---|---|---|
0.127 | beta^0^ Thalassemia | NA | CLINVAR | Detail | |
0.672 | beta thalassemia | NA | CLINVAR | Detail |
Annotation
Annotations
Descrption | Source | Links |
---|---|---|
NM_000518.5(HBB):c.93-22_95del AND Beta zero thalassemia | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND beta Thalassemia | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND not provided | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND not specified | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND Inborn genetic diseases | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND Beta-thalassemia HBB/LCRB | ClinVar | Detail |
NM_000518.5(HBB):c.93-22_95del AND Malaria, susceptibility to | ClinVar | Detail |
NA | DisGeNET | Detail |
NA | DisGeNET | Detail |
Overlapped Transcript Coordinates
Gene | Transcript ID | Exon Number | Chromosome | Start | Stop | Type | Amino Mutation | Transcript Position | Links |
---|
Overlapped Transcript
Gene | Transcript ID | Chromosome | Start | Stop | Links |
---|
- Gene
- -
- dbSNP
- rs193922563 dbSNP
- Genome
- hg19
- Position
- chr11:5,248,028-5,248,052
- Variant Type
- snv
- Reference Allele
- GCCTAAGGGTGGGAAAATAGACCAA
- Alternative Allele
- -
Genome browser